• Synthetic sgRNA for CRISPR-Cas9 experiments

    Synthetic single guide RNA for CRISPR-Cas9 experiments

    CRISPR-Cas9 genome editing with a synthetic single guide RNA (sgRNA)

    Required components for CRISPR-Cas9 gene editing and synthesis of guide RNA

    The CRISPR-Cas9 system allows researchers to quickly edit genes for functional protein knockout in mammalian, fish and plant genomes, among others, and consequently has dramatically transformed biological research. The natural Streptoccocus pyogenes CRISPR-Cas9 system requires three components: 1. Cas9 nuclease, 2. CRISPR RNA (crRNA) comprised of targeting and repeat sequences, and 3. tracrRNA, which hybridizes to the crRNA through its anti-repeat sequence. The crRNA:tracrRNA complex recruits the Cas9 nuclease and cleaves DNA upstream of a protospacer-adjacent motif (PAM). The crRNA and tracrRNA can be linked together with a loop sequence for generation of a chimeric single guide RNA (sgRNA; Hsu et al. 2013). sgRNA can be generated for DNA-based expression or by chemical synthesis. Using patented Dharmacon 2'-ACE chemistry (Scaringe et al. 1998, Scaringe et al. 2004), long RNA can be routinely synthesized with faster coupling rates, higher yields and greater purity and is ideal for generating synthetic sgRNAs.

    Sequence structure of single guide RNA

    Below is one example of how to design a S. pyogenes sgRNA (Hendel et. al. 2015) for chemical synthesis:

    • 20 nucleotide (nt) targeting sequence (shown as poly N)
    • 12 nt of the crRNA repeat sequence
    • 4 nt of tetraloop sequence (underlined)
    • 64 nt of tracrRNA sequence

    5'- NNNNNNNNNNNNNNNNNNNNGUUUUAGAGCUAGAAA
    UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU -3'

    Benefits of synthetic sgRNA in gene editing

    Although the synthetic two-part RNA (crRNA:tracrRNA) system is efficient and cost-effective for most applications, researchers working with in vivo and ex vivo models have indicated a preference for a sgRNA system. The advantages to using a synthetic sgRNA compared to plasmid-expressed or in vitro transcribed sgRNA include:

    • A single oligonucleotide, arrives ready to use
    • No cloning, sequencing, or in vitro transcription required
    • Options for completely DNA-free gene editing when combined with Cas9 mRNA or Cas9 protein
    • Allows for incorporation of chemical modifications

    Ordering a synthetic sgRNA

    Custom synthetic sgRNAs can be ordered in two ways:

    • Use the CRISPR RNA Configurator to design and order custom synthetic sgRNA in tubes or 96-well plates. For S. pyogenes sgRNA, simply input a 17 to 23 nt targeting sequence. The repeat, loop and tracrRNA sequence as well as our recommended 2xMS nuclease stability modifications will automatically be added. For other Cas9 species and designs, input the entire sgRNA sequence with length ranging between 97-103 nt. All synthetic sgRNAs ordered through the CRISPR RNA Configurator tool are verified by MALDI-TOF mass spectrometry for correct identity and purified to result in high editing efficiency.
    • Use the Custom single-strand RNA synthesis ordering tool if you require custom modifications or specific purification for your application. The custom single-stranded RNA synthesis tool supports lengths up to 105 nt at the 0.4 µmol synthesis scales with HPLC or PAGE purification options. If you require guaranteed yields above 1 nmol, please contact Technical Support.

    Featured Products

    Featured Resources

    References:

    1. Briner, A.E., Donohoue, P.D., et al. , Guide RNA functional modules direct Cas9 activity and orthogonality. Mol Cell. 56(2), 333-339 (2014).
    2. Hsu, P.D., Scott, D.A., et al., DNA targeting specificity of RNA-guided Cas9 nucleases. Nat. Biotechnol. 31(9), 827-832 (2013).
    3. Hendel, A, et. al. Chemically modified guide RNAs enhance CRISPR-Cas genome editing in human primary cells. Nat.Biotechnol. 33, 985-989 (2015).
    4. Scaringe, S.A. et al., Novel RNA synthesis method using 5´-silyl-2´-orthoester protecting groups. J. Am. Chem. Soc. 120:11820-11821 (1998).
    5. Scaringe, S.A. et al., Preparation of 5´-silyl-2´-orthoester ribonucleosides for use in oligoribonucleotide synthesis. Curr. Protoc. Nuc. Acid Chem. 2.10.1-2.10.16 (2004).

Share: