• Synthetic sgRNA for CRISPR-Cas9 experiments

    Synthetic sgRNA for CRISPR-Cas9 experiments

    CRISPR-Cas9 genome editing with a synthetic 99-mer single guide RNA

    Required components for CRISPR-Cas9 gene editing and synthesis of guide RNA

    The CRISPR-Cas9 system allows researchers to quickly edit genes for functional protein knockout in mammalian, fish and plant genomes, among others, and consequently has dramatically transformed biological research. The natural CRISPR-Cas9 system requires three components: 1. Cas9 nuclease, 2. CRISPR RNA (crRNA) comprised of spacer-derived sequence and of repeat-derived sequence, and 3. tracrRNA, which hybridizes to the crRNA through repeat-derived sequences. The crRNA:tracrRNA complex recruits the Cas9 nuclease and cleaves DNA upstream to a protospacer-adjacent motif (PAM). The crRNA and tracrRNA can be linked together with a loop sequence for generation of a chimeric single guide RNA (sgRNA; Hsu et al. 2013). sgRNA can be generated for DNA-based expression or by chemical synthesis. With traditional chemistries, such as 2'-silyl (TBDMS or TOM) protection strategies, it can be challenging to accurately and efficiently synthesize RNA greater than ~ 70 bases. Using patented Dharmacon 2'-ACE chemistry (Scaringe et al. 1998, Scaringe et al. 2004), long RNA can be routinely synthesized with faster coupling rates, higher yields and greater purity and is ideal for generating synthetic sgRNAs.

    Benefits of synthetic sgRNA in gene editing

    Although a natural synthetic two RNA (crRNA:tracrRNA) system is very efficient and cost-effective for most applications, researchers working with in vivo and ex vivo models have indicated a preference for a sgRNA system. The advantages to using a synthetic sgRNA compared to plasmid-expressed or in vitro transcribed (IVT) sgRNA include:

    • A single oligonucleotide, arrives ready to use
    • No cloning and sequencing steps or IVT reactions to perform
    • Options for completely DNA-free gene editing when combined with Cas9 mRNA or Cas9 protein
    • Potential for incorporation of chemical modifications

    Sequence structure of sgRNA

    Below is one example of how to design a sgRNA (Hsu et al. 2013) for chemical synthesis:

    • 20 nt targeting sequence
    • 12 nt of the crRNA repeat sequence
    • 4 nt of tetraloop sequence (underlined)
    • 63 nt of tracrRNA sequence

    5'- NNNNNNNNNNNNNNNNNNNNGUUUUAGAGCUAGAAA
    UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU -3'

    Ordering a synthetic sgRNA

    Custom single-strand RNA synthesis ordering supports lengths up to 105 nt at the 0.4 µmol synthesis scale and is suitable for ordering single guide RNAs. It is recommended to include HPLC purification and 2’-deprotect/desalt to reduce the presence of non-full length RNAs in the final product. Final amounts typically achieved with this processing are 3-5 nmol but will vary depending on the RNA length.

    Featured Products

    Featured Resources

    References:

    1. Briner, A.E., Donohoue, P.D., et al. , Guide RNA functional modules direct Cas9 activity and orthogonality. Mol Cell. 56(2), 333-339 (2014).
    2. Hsu, P.D., Scott, D.A., et al., DNA targeting specificity of RNA-guided Cas9 nucleases. Nat. Biotechnol. 31(9), 827-832 (2013).
    3. Scaringe, S.A. et al., Novel RNA synthesis method using 5´-silyl-2´-orthoester protecting groups. J. Am. Chem. Soc. 120:11820-11821 (1998).
    4. Scaringe, S.A. et al., Preparation of 5´-silyl-2´-orthoester ribonucleosides for use in oligoribonucleotide synthesis. Curr. Protoc. Nuc. Acid Chem. 2.10.1-2.10.16 (2004).

Share: