Edit-R Predesigned crRNA

Algorithm-optimized synthetic crRNA for genome-wide coverage of human, mouse, or rat genes. Simply search for your gene!


Edit-R Predesigned crRNA
Designed with an algorithm to improve functional knockout and provide best-in-class specificity checking. Genome-wide synthetic CRISPR RNA reagents for rapid, high-confidence analysis of multiple genes at multiple target sites.

Enter a common gene identifier and click SEARCH to find products for your gene.

 
Edit-R Human synthetic crRNA
CM-HUMAN-XX-0002 2 nmol - $95.00select
Edit-R Mouse synthetic crRNA
CM-MOUSE-XX-0002 2 nmol - $95.00select
Edit-R Rat synthetic crRNA
CM-RAT-XX-0005 5 nmol - $175.00select

Functional and specific targeting for high-confidence gene knockout results

CRISPR-Cas9 is a highly effective tool for interrogating gene function, yet not all guide RNAs (gRNA) are effective in attaining functional protein knockout. To address this problem, Dharmacon developed an algorithm that is trained and validated for functional knockout, not just the ability to create double-strand breaks (DSB). With pre-designed CRISPR RNA (crRNA) you can quickly and easily assess multiple crRNA per gene, for many different genes.

Edit-R crRNA is a chemically synthesized RNA, comprised of 20 nucleotides identical to the genomic DNA target site, or protospacer, followed by the required S. pyogenes repeat sequence that interacts with the tracrRNA, which is required for use with synthetic crRNA. The chosen 20-base target sequence in the gene is immediately upstream of a protospacer-adjacent motif (PAM) in the genomic DNA. 

As of February 2017, chemical modifications are applied to all predesigned crRNAs to resist degradation by nucleases to improve performance in applications using co-delivery with DNA-free Cas9. Learn more about these changes in this featured article. Researchers who have previously purchased items with a CR- catalog number and wish to get modified crRNAs with the same design, please contact Technical Support.

Highlights of the Edit-R algorithm for pre-designed crRNA and sgRNA:

  • The Edit-R algorithm’s alignment tool identifies mismatches AND gaps to optimize selection of highly specific target sequences
  • Developed on functional gene knockout rather than measurement of DSB in the genomic target DNA

Required components for an Edit-R CRISPR-Cas9 gene engineering experiment using synthetic crRNA:

  • A plasmid, protein, mRNA, or lentiviral vector expressing a mammalian codon-optimized gene sequence encoding Cas9 nuclease
  • A chemically synthesized trans-activating CRISPR RNA (tracrRNA), and
  • A chemically synthesized CRISPR RNA (crRNA) designed to the gene target site of interest

How much crRNA & tracrRNA do I need?

This table provides the approximate number of experiments that can be carried out for lipid transfection methods at the recommended crRNA:tracrRNA working concentration (25 nM:25nM) in various plate/well formats. Calculations do not account for pipetting errors.
crRNA
nmol
tracrRNA
nmol
96-well plate
100 µL reaction volume
24-well plate
500 µL reaction volume
12-well plate
1000 µL reaction volume
6-well plate
2500 µL reaction volume
2 2 800 160 80 32
5 5 2000 400 200 80
10 10 4000 800 400 160
20 20 8000 1600 800 320

 

  
HazardousNo
Shipping ConditionAmbient
Stability at Recommended Storage ConditionsAt least 12 months
Storage Condition-20 C
function_comparison.jpg

crRNA with high scores from the Edit-R algorithm have higher cleavage efficiency than low-scoring designs

function_comparison.jpg

10 crRNAs with high functional scores for 10 genes (blue bars) and 10 crRNAs with low functional scores for the same genes (yellow bars) were tested for editing by Next Generation Sequencing. 93% of the high-scoring crRNAs and 32 % of the low scoring crRNAs showed > 40% of editing (indel formation). The Cas9-HEK293T cell line was transfected with 50 nM crRNA:tracrRNA, using 0.25 µL/well of DharmaFECT 1. Seventy-two hours post-transfection, cells were lysed and Nextera transposon-adapted amplicons spanning each crRNA site were generated for every treated sample as well as for a matched control amplicon from untransfected samples. Samples were indexed using the Nextera 96-well index kit and pooled for sequencing on a MiSeq instrument (paired end reads, 2 x 300 length). Reads that passed NGS quality filtering criteria were aligned to the reference file (Bowtie2 v2.1.0). Percent perfect reads were calculated and normalized to the control untransfected samples (Samtools v0.1.12a); the data is presented as normalized percent edited.


Edit-R crRNA:tracrRNAs elicit virtually no innate immune response or toxicity compared to in vitro transcribed guide RNA

Edit-R crRNA:tracrRNAs cause virtually no innate immune response or toxicity compared to in vitro transcribed guide RNA

Edit-R crRNA:tracrRNAs elicit virtually no innate immune response or toxicity compared to in vitro transcribed guide RNA

HEK293T cells stably expressing Cas9 nuclease were transfected with the indicated guide RNA targeting PPIB or DNMT3B. Edit-R unmodified products (crRNA:tracrRNA) and those modified to resist degradation (2xMS crRNA:2xMS tracrRNA) both maintain cell viability and stimulate virtually no immune response. 3xMS modified crRNA:tracrRNA reagents are more toxic to cells. Cellular viability was assessed with a Resazurin metabolism assay (red dots) and the levels of five immune response genes were quantified by qRT-PCR. MS= 2’-O-Methyl ribose and phosphorothioate backbone linkage.


Position and structure of modifications for improved nuclease resistance on Edit-R synthetic crRNA and tracrRNA

Position and structure of modifications for improved nuclease resistance on Edit-R synthetic crRNA and tracrRNA

Position and structure of modifications for improved nuclease resistance on Edit-R synthetic crRNA and tracrRNA

A. Position of modifications for nuclease resistance on Edit-R synthetic crRNA and tracrRNA. Edit-R synthetic guide RNAs contain 2ʹ-O-methyl (2ʹ-OMe) and backbone phosphorothioate linkages (PS) on the two nucleotides at the 5ʹ end of the crRNA (green strand) and on the two nucleotides at the 3’ end of the tracrRNA (blue strand). B. Structure of the 2ʹ-OMe and PS backbone phosphorothioate linkages.


synthetic-crrna-tracrrna-compatible-cas9-nuclease-formats.jpg

Synthetic crRNA:tracrRNA is compatible with all Cas9 Nuclease formats

synthetic-crrna-tracrrna-compatible-cas9-nuclease-formats.jpg

U2OS cells were plated at 10,000 cells/well one day prior to transfection. Cells were transfected with either Edit-R Cas9 Nuclease plasmid (200 ng), Edit-R Cas9 Nuclease mRNA(200 ng) or Cas9 nuclease protein (25 nM) and crRNA:tracrRNA (25 nM) targeting PPIB using DharmaFECT Duo transfection reagent (0.4 uL/well) in biological triplicates.


coelectroporation-crrna-tracrrna-cas9-mrna-protein-web.gif

Efficiency of gene editing with 2x MS modified or unmodified crRNA:tracrRNA

coelectroporation-crrna-tracrrna-cas9-mrna-protein-web.gif

A. Modifications to block degradation by nucleases are required for successful co-electroporation of Cas9 mRNA and crRNA:tracrRNA. B. Co-electroporation of Cas9 protein and crRNA:tracrRNA does not require stabilizing modifications, but results may be improved with their addition.


Efficient gene editing in Cas9-expressing NIH/3T3 cell lines by transfection with Edit-R crRNA:tracrRNA

Efficient gene editing in Cas9-expressing NIH/3T3 cell lines by transfection with Edit-R crRNA:tracrRNA

Efficient gene editing in Cas9-expressing NIH/3T3 cell lines by transfection with Edit-R crRNA:tracrRNA

NIH/3T3 cells were stably transduced with lentiviral particles containing Cas9 and a blasticidin resistance gene driven by the indicated promoters. A population of stably integrated cells were selected with blasticidin for a minimum of 10 days before transfections. Cells were transfected with 50 nM Edit-R synthetic crRNA:tracrRNA targeting PPIB using DharmaFECT 1 transfection reagent. After 72 hours, the relative frequency of gene editing was calculated based on a DNA mismatch detection assay with T7 Endonuclease I.


apo-one-box-plots.gif

crRNAs with high functional scores from the Edit-R algorithm show stronger phenotypes in ApoONE assay than low-scoring designs

apo-one-box-plots.gif

U2OS-Proteasome cells with integrated Cas9 (under CAG promoter) were plated in 96-well plates at 10,000 cells per well. 24 h after plating, cells were transfected with 25 nM crRNA:tracrRNA using 0.2 µg/well of DF4. Cell were analyzed for apoptosis 48 h after transfection using the ApoONE homogeneous assay (Promega). For the box plot, the crRNAs were divided into bottom half (H1) and top half (H2) based on their Edit-R algorithm functional score (110 total data points represented). The medians, distribution of data between the lower and upper halves and the minimum and maximum values demonstrate that high-scoring crRNAs have increased functionality.


Designs with gaps & mismatches can cause off-target cleavage

Designs with gaps & mismatches can cause off-target cleavage

Designs with gaps & mismatches can cause off-target cleavage

T7E1 mismatch analysis for a crRNA showing the intended target site (GGTCATCTGGGAGAAAAGCG) and a predicted off-target site that was identified by the Edit-R alignment tool but no other online tool, containing one gap and one mismatch (GGT-ATCTGGGAGAAAAGCa) Many commonly used web-based crRNA specificity tools do not fully account for gaps when performing alignments.


edit-r-data-figure11.jpg

Functional protein knockout of VCP is observed in a cell-based assay using stably-expressed Cas9 and Edit-R synthetic crRNA:tracrRNA in a recombinant U2OS line.

edit-r-data-figure11.jpg

A recombinant U2OS ubiquitin-EGFP proteasome cell line (Ubi[G76V]-EGFP) was stably transduced with lentiviral particles containing Edit-R plasmid vectors expressing Cas9 nuclease and blasticidin resistance gene under the control of the indicated promoters. A population of cells with stably integrated Cas9-BlastR was selected with blasticidin-treatment for a minimum of 10 days before transfections. Cells were transfected with 50 nM Edit-R synthetic crRNA:tracrRNA complex targeting VCP, a gene required for proteasome function, using DharmaFECT 3 Transfection Reagent. After 72 hours, transfected cells were examined for EGFP+ cells (upper panel) and the relative frequency of gene editing was calculated (lower panel) based on a DNA mismatch detection assay with T7 Endonuclease I.


References

  1. R. Barrangou, A. Birmingham, et. al. Advances in CRISPR-Cas9 genome engineering: lessons learned from RNA interference. Nucleic Acids Research, 43(7) 3407-3419 (2015)
  2. M.L. Kelley, Ž. Strezoska, et al. Versatility of chemically synthesized guide RNAs for CRISPR-Cas9 genome editing. J. Biotechnol. 233, 74–83 (2016). doi:10.1016/j.jbiotec.2016.06.011 

Citations

  1. G. Sivan, P. Ormanoglu, et al. Identification of Restriction Factors by Human Genome-Wide RNA Interference Screening of Viral Host Range Mutants Exemplified by Discovery of SAMD9 and WDR6 as Inhibitors of the Vaccinia Virus K1L-C7L- Mutant. mBio. B(4), e01122 (2015). doi: 10.1128/mBio.01122-15 http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4526713/

    Edit-R crRNA:tracrRNA to generate knockout cells lines for RNAi hit validation

  2. D. Wulan, S. Xinghua, et al. CASFISH: CRISPR/Cas9-mediated in situ labeling of genomic loci in fixed cells. PNAS. 112(38), 11870–11875 (2015). http://www.ncbi.nlm.nih.gov/pubmed/26324940

    Custom designed Edit-R crRNA
  3. J. McCaffrey, J. Sibert, et al. CRISPR-CAS9 D10A nickase target-specific fluorescent labeling of double strand DNA for whole genome mapping and structural variation analysis. Nucleic Acids Res. 44(2), e11 (2016). doi: 10.1093/nar/gkv878 http://www.ncbi.nlm.nih.gov/pubmed/26481349

    CRISPR-Cas9 D10A nickase used with Edit-R crRNA:tracrRNA
  4. S. Opp, D.A.S.A. Vieira, et al. MxB Is Not Responsible for the Blocking of HIV-1 Infection Observed in Alpha Interferon-Treated Cells. J. Virol. 90, 3056-3064 (2015). doi:10.1128/JVI.03146-15  http://www.ncbi.nlm.nih.gov/pubmed/26719253

    MxB knockout (KO) cell lines were generated by using Edit-R Cas9 Nuclease expression plasmid and crRNA:tracrRNA
  5. J. Tan, Martin, SE (2016) Validation of Synthetic CRISPR Reagents as a Tool for Arrayed Functional Genomic Screening. PLoS ONE 11(12): e0168968. doi:10.1371/journal.pone.0168968

    Arrayed crRNA library screening (Edit-R Ubiquitin Enzymes library)

  6. H. Ogiwara, M. Sasaki, et al. Targeting p300 addiction in CBP-deficient cancers causes synthetic lethality by apoptotic cell death due to abrogation of MYC expression. Cancer Discov. 2016 Apr;6(4):430-45. doi: 10.1158/2159-8290.CD-15-0754. Epub 2015 Nov 24 http://www.ncbi.nlm.nih.gov/pubmed/26603525

    HEK293T CBP-KO cells (#2-4) bearing a 1 bp insertion in exon 9 of CBP were constructed using Edit-R Cas9 Nuclease expression plasmid and crRNA:tracrRNA

  7. A. Paix, H. Schmidt, et al. Cas9-assisted recombineering in C. elegans: genome editing using in vivo assembly of linear DNAs. Nucleic Acids Res. (2016). doi:10.1093/nar/gkw502 2015 

  8. M.L. Kelley, Ž. Strezoska, et al. Versatility of chemically synthesized guide RNAs for CRISPR-Cas9 genome editing. J. Biotechnol. 233, 74–83 (2016). doi:10.1016/j.jbiotec.2016.06.011 
  9. J.F. Hultquist, K. Schumann, et al. A Cas9 Ribonucleoprotein Platform for Functional Genetic Studies of HIV-Host Interactions in Primary Human T Cells. Cell Reports. 17, 1438–1452 (2016). dx.doi.org/10.1016/j.celrep.2016.09.080 
  10. K. He, E. Chou, et al. Conjugation and evaluation of triazole-linked single guide RNA for CRISPR-Cas9 gene editing. ChemBioChem. 17, 1809–1812 (2016).doi:10.1002/cbic.201600320 

Application Notes

Posters and Presentations

Protocols

Safety Data Sheets