Edit-R Predesigned Lentiviral sgRNA

Genome-wide sgRNAs designed for efficient gene knockout with unparalleled specificity; available as glycerol stocks and high-titer purified particles.


Edit-R Predesigned Lentiviral sgRNA
Designed with an algorithm to improve functional knockout and provide best-in-class specificity checking. Predesigned, sgRNAs enable high-confidence gene editing experiments without the need for laborious cloning or lentiviral packaging.

Enter a common gene identifier and click SEARCH to find products for your gene.

 
Edit-R Human Lentiviral sgRNA
GSGH11838 glycerol stock - $450.00select
Set of 3 Edit-R Human Lentiviral sgRNA
GSGH11841 glycerol stock - $1,200.00select
Edit-R Mouse Lentiviral sgRNA
GSGM11839 glycerol stock - $450.00select
Set of 3 Edit-R Mouse Lentiviral sgRNA
GSGM11842 glycerol stock - $1,200.00select
Edit-R Rat Lentiviral sgRNA
GSGR11840 glycerol stock - $450.00select
Set of 3 Edit-R Rat Lentiviral sgRNA
GSGR11843 glycerol stock - $1,200.00select

Functional and specific targeting for high-confidence gene knockout results

CRISPR-Cas9 is a highly effective tool for interrogating gene function, yet not all guide RNAs (gRNA) are effective in attaining functional protein knockout. To address this problem, Dharmacon developed an algorithm that is trained and validated for functional gene knockout, not just the ability to create insertions and deletions (indels). Edit-R pre-designed lentiviral single guide RNA (sgRNA) are CRISPR reagents for generating functional gene knockouts in difficult-to-transfect cells or for following up hits from a pooled lentiviral sgRNA library screen.

Edit-R Lentiviral sgRNAs express a chimeric structure comprised of a crRNA and tracrRNA fused through a short linker for the programming of Cas9 nuclease and creation of DNA double-strand breaks (DSBs). In the Edit-R lentiviral sgRNA vector backbone, the gene-specific crRNA and tracrRNA are expressed under the control of a human U6 promoter, while expression of the puromycin resistance marker (PuroR) is driven from the mouse CMV promoter and allows for rapid selection of cells with integrated sgRNA. Each Edit-R Lentiviral sgRNA is specific to the gene or genomic site of choice. The crRNA region of the sgRNA is comprised of 19-20 nucleotides identical to the genomic DNA target site followed by the non-variable sgRNA scaffold containing the tracrRNA sequence from S. pyogenes.

The Edit-R Lentiviral Gene Engineering system utilizes Cas9 nuclease and the sgRNA in a two-step process. First, Edit-R Lentiviral Cas9 Nuclease Expression particles are utilized to generate cell lines stably expressing Cas9 nuclease. These cells can subsequently be transduced with Edit-R Lentiviral sgRNA particles to achieve efficient gene editing for phenotypic analyses in a population of cells or in isolated clonal cell lines.

Highlights of the Edit-R algorithm for pre-designed sgRNA:

  • The Edit-R algorithm's alignment tool identifies mismatches AND gaps to optimize selection of highly specific target sequences; and
  • The Edit-R algorithm scores were developed on functional gene knockout rather than just quantifying indels in the genomic target DNA.

Pre-designed Edit-R Lentiviral sgRNAs are supplied as glycerol stocks and as concentrated high-titer particles for straightforward delivery into Cas9-expressing cells for efficient knockout without need for cloning or packaging. Purified, concentrated lentiviral particles can be directly transduced into difficult-to-transfect cells without the toxic cellular debris and contaminants found in supernatant preparations.Glycerol stocks can be grown and the expression plasmid purifed for immediate transfection or packaging into particles.

  • Save money by eliminating time-consuming cloning, packaging and titering steps
  • High-quality, concentrated, purified lentiviral particles for direct transduction with minimal cytotoxicity
  • Pre-designed sgRNA generated using the Edit-R CRISPR RNA algorithm for unparalleled specificity and functionality
  
HazardousNo
Shelf Life12 Months
Shipping ConditionDry Ice,Frozen Gel Packs
Storage Condition-80 C
sgRNA-exp-workflow.jpg

Experimental workflow using Edit-R Lentiviral sgRNA

sgRNA-exp-workflow.jpg

Experimental workflow using Edit-R Lentiviral sgRNA. Edit-R Lentiviral sgRNA are transduced into a stable cell line expressing Cas9 nuclease for efficient gene knockout, even at low MOIs.


sgrna-function-ppib-vcp.jpg

Testing gene editing with Cas9 under control of different promoters show that high levels of gene editing are achieved with Edit-R Lentiviral sgRNA in multiple cell lines.

sgrna-function-ppib-vcp.jpg

Testing gene editing with Cas9 under control of different promoters show that high levels of gene editing are achieved with Edit-R Lentiviral sgRNA in multiple cell lines. A recombinant U2OS ubiquitin-EGFP proteasome cell line (Ubi[G76V]-EGFP) and HEK293T cells were stably transduced with lentiviral particles containing Cas9 and a blasticidin resistance gene. A population of stably integrated cells were selected with blasticidin for a minimum of 10 days before transduction with sgRNAs. Cells were transduced with sgRNA lentiviral particles at low MOI to obtain cells with one integrant and selected with puromycin for seven days prior to analysis. The relative frequency of gene editing in the puromycin-selected cells was calculated from a DNA mismatch detection assay using T7 Endonuclease I.


LV-2-vector-system-map-and-table.jpg

Schematic maps and table of vector elements of the Edit-R Lentiviral Cas9 Nuclease (A) and sgRNA (B) vectors.

LV-2-vector-system-map-and-table.jpg

The Edit-R Lentiviral CRISPR-Cas9 platform is a two-vector system that utilizes a lentiviral vector with multiple Pol II promoter options for maximal Cas9 expression and a gene-specific vector for sgRNA expression designed to the target site of interest.


Schematic map of the plasmid vector elements of the Edit-R Lentiviral sgRNA vector.

Schematic map of the plasmid vector elements of the Edit-R Lentiviral sgRNA vector.

Schematic map of the plasmid vector elements of the Edit-R Lentiviral sgRNA vector.

In the Edit-R Lentiviral sgRNA vector backbone, the gene-specific crRNA and the tracrRNA are expressed under the control of a human U6 promoter, while expression of the puromycin resistance marker (PuroR) is driven from the mouse CMV promoter and allows for rapid selection of cells with integrated sgRNA. The plasmid contains the AmpR resistance marker for growth and selection in E. coli.


Algorithm applies to both synthetic crRNAs and expressed sgRNAs

Algorithm applies to both synthetic crRNAs and expressed sgRNAs

Algorithm applies to both synthetic crRNAs and expressed sgRNAs

Here we are targeting the gene PSMD11 at 12 different sites and measuring functionality by EGFP signal to indicate disruption of the proteasome. Cells were either transfected with crRNA:tracrRNAs, or transduced with lentiviral particles for expression of a sgRNA of the same design. There is no significant difference between the two guide RNA formats when targeting the same genomic site; a good design for crRNA will translate into a good design for sgRNA.


Designs with gaps & mismatches can cause off-target cleavage

Designs with gaps & mismatches can cause off-target cleavage

Designs with gaps & mismatches can cause off-target cleavage

T7E1 mismatch analysis for a crRNA showing the intended target site (GGTCATCTGGGAGAAAAGCG) and a predicted off-target site that was identified by the Edit-R alignment tool but no other online tool, containing one gap and one mismatch (GGT-ATCTGGGAGAAAAGCa) Many commonly used web-based crRNA specificity tools do not fully account for gaps when performing alignments.


Successful CRISPR-Cas9 gene editing utilizing co-delivery of Edit-R Lentiviral sgRNA and Cas9 expression plasmid using DharmaFECT kb transfection reagent

Successful CRISPR-Cas9 gene editing utilizing co-delivery of Edit-R Lentiviral sgRNA and Cas9 expression plasmid using DharmaFECT kb transfection reagent

Successful CRISPR-Cas9 gene editing utilizing co-delivery of Edit-R Lentiviral sgRNA and Cas9 expression plasmid using DharmaFECT kb transfection reagent

U2OS cells were transfected with equal amounts of Edit-R hCMV-mKate2-Cas9 Expression plasmid (Cat #U-004100-120) and Edit-R Human PPIB Lentiviral sgRNA plasmid in a 96-well format. Transient transfections were done with increasing amounts of total DNA (50 to 200 ng) and DharmaFECT kb transfection reagent (Cat #T-2006-01), 0.2 to 0.8 µL per well. The percentage of gene editing was estimated 72 hours after transfection by DNA mismatch detection assay using T7EI with gel densitometry.


Co-transfection of Edit-R Lentiviral sgRNA and Edit-R Cas9 Nuclease expression plasmids with DharmaFECT kb transfection reagent allows consistent gene editing in U2OS cells.

Co-transfection of Edit-R Lentiviral sgRNA and Edit-R Cas9 Nuclease expression plasmids with DharmaFECT kb transfection reagent allows consistent gene editing in U2OS cells.

Co-transfection of Edit-R Lentiviral sgRNA and Edit-R Cas9 Nuclease expression plasmids with DharmaFECT kb transfection reagent allows consistent gene editing in U2OS cells.

U2OS cells were transfected with equal amounts of Edit-R hCMV-mKate2-Cas9 Expression plasmid (Cat #U-004100-120) and Edit-R Human PPIB Lentiviral sgRNA plasmid (Cat #GSGH11829) in a 96-well format. Transient transfections were done with increasing amounts of total DNA (50 to 200 ng) and DharmaFECT kb transfection reagent (Cat #T-2006-01, 0.2 to 0.8 µL per well). The percentage of gene editing was estimated 72 hours after transfection by DNA mismatch detection assay using T7EI with gel densitometry. Lanes shown are representatives of triplicate samples. UT, untransfected control.