miRIDIAN microRNA Hairpin Inhibitor Negative Control #2

Differentiate between specific and non-specific effects with a negative control inhibitor

Choose from two universal miRIDIAN Hairpin Inhibitor Negative Controls for experiments with miRIDIAN microRNA Hairpin Inhibitors. Negative control sequences based on C. elegans microRNAs have minimal sequence identity in human, mouse, and rat.
miRIDIAN microRNA Hairpin Inhibitor Negative Controls are ideal for optimizing conditions for relevant, well-controlled microRNA modulation experiments. Both positive and negative control molecules are provided for loss-of-function microRNA studies.


  • Based on cel-miR-239b, mature sequence: UUGUACUACACAAAAGUACUG (MIMAT0000295
  • Cel-miR-239b confirmed to have minimal sequence identity with miRNAs in human, mouse, and rat
  • Identical design and modifications as miRIDIAN microRNA Hairpin Inhibitors
  • No identifiable effects on tested miRNA function (see Figure 1, Supporting Data)


  • Non-targeting inhibitors for use as controls in miRNA inhibition experiments
  • Distinguish between specific inhibitor activity and background effects
Submit an online quote request for larger quantities of RNAi Controls or siRNA Libraries.
Shelf Life12 Months
Shipping ConditionAmbient
Storage Condition-20 C
miRIDIAN Hairpin Inhibitor Negative Controls distinguish between miRNA-specific and non-specific effects

miRIDIAN Hairpin Inhibitor Negative Controls distinguish between miRNA-specific and non-specific effects

miRIDIAN Hairpin Inhibitor Negative Controls distinguish between miRNA-specific and non-specific effects

Figure 1. | Effects of miRIDIAN microRNA Hairpin Inhibitor Negative Controls on the function of miR-21 were assayed at 48 hours after transfection of 5 nM inhibitor or negative control in H9c2, NIH3T3, or HeLa cells using DharmaFECT Duo and a dual luciferase reporter system.